Вторник, 18.06.2019, 16:53
Высшее образование
Приветствую Вас Гость | RSS
Поиск по сайту



Главная » Статьи » Животные. Зоотехника

ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ ЦИТОХРОМА b мтДНК В СЕВЕРООХОТОМОРСКОЙ ПОПУЛЯЦИИ ЗВЕЗДЧАТОЙ КАМБАЛЫ (Platichthys stellatus)

С.П. Пустовойт, кандидат биологических наук
Р.Р. Юсупов, кандидат биологических наук

ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ ЦИТОХРОМА b мтДНК В СЕВЕРООХОТОМОРСКОЙ ПОПУЛЯЦИИ ЗВЕЗДЧАТОЙ КАМБАЛЫ
(Platichthys stellatus)

Анализ нуклеотидных последовательностей фрагмента гена цитохром b митохондриальной ДНК (фрагмент длиной 633 нуклеотида) у 52 особей звездчатой камбалы из Тауйской губы (Охотское море) позволил определить уровни гаплотипического (Hd = 0,904 ± 0,00511) и нуклеотидного разнообразия (p = 0,00645 ± 0,0000998). Отмеченные количественные показатели превышают аналогичные для гена цитохромоксидаза субъединицы 1 мтДНК в той же популяции звездчатой камбалы. В исследованной популяции обнаружено две сово-
купности особей, рельефно отличающихся по набору нуклеотидов в некоторых сайтах. Определение современного уровня генетического разнообразия промысловой популяции звездчатой камбалы позволяет начать организацию ее генетического мониторинга.

Ключевые слова: звездчатая камбала, цитохром b мтДНК, генетическое разнообразие, Охотское море. 

 

Наше предыдущее сообщение, опубликованное в Вестнике СВГУ № 25, было посвящено описанию генетического разнообразия гена цитохромоксидаза мтДНК у звездчатой камбалы (Platichthys stellatus, Pleuronectidae, Pleuronectiformes), отловленной в Тауйской губе Охотского моря [1]. Выбор объекта исследования определяем промысловой значимостью звездчатой камбалы. В Охотском море она обитает повсеместно, промысел ведется в летние месяцы во время подхода к прибрежным участкам самцов и самок для нереста [2-4]. Рациональная эксплуатация запасов вида помимо ихтиологических исследований нуждается в т. ч. и в мониторинге уровня генетического разнообразия [5]. Промысел (изъятие части популяции) не должен приводить к снижению оптимального уровня генетического разнообразия [6]. В последнее время ставится задача разработать практические рекомендации по теоретическим положениям так называемой природоохранной генетике [7].

Цель работы

Оценить генетическое разнообразие промысловой популяции звездчатой камбалы Тауйской губы Охотского моря.

Материалы и методы

Особи звездчатой камбалы в количестве 52 штук, отловлены в июле 2012 г. в Амах- тонском заливе. Пробы мышц хранились в замороженном состоянии, а затем заливались этанолом.

Определение нуклеотидной последовательности фрагмента гена цитохром b выполнено в ЗАО «Синтол», г. Москва. Для поли- меразной цепной реакции использованы следующие праймеры [8)];

Cytb-F:
5'ATGGCCAACCTCCGTAAATCCCACCCCCTT3'

Cytb-R:
5' CTGGGGCTCTGGACGCTGA GCTACTAGTGC 3'.

Последовательности фрагмента гена мтДНК были выровнены при помощи программы Clustal W, входящей в пакет MEGA 6,0 [9]. Для конструирования дендро- грамм использовали р-дистанции, метод кластеризации для построения дендро- грамм - невзвешанный попарно-групповой (UPGMA). Показатели гаплотипического и нуклеотидного разнообразия, а также тест Таджимы подсчитывали при помощи программы статистической анализа генетических данных DnaSP [10].

Результаты

Исследуемый фрагмент гена у всех особей состоит из 633 нуклеотидов. Одинаковая длина нуклеотидной последовательности фрагмента гена позволяет провести корректный статистический анализ. Обнаружено 34 полиморфных сайта, что определяет величину их доли ps = 34/633 = 0,053712. Сайты сильно различаются величиной изменчивости, наблюдаются сайты с единичными заменами до (например, № 5 или № 6) до высоко-полиморфных (табл. 1). Количество транзиций выше, чем трансверсий, их отношение R = 1,2059 ± 0,02742.

Указанные полиморфные сайты формируют 32 гаплотипа. Самая крупная гаплотипическая группа (Нар-16) состоит из 16 особей, две группы из трех особей (Hap-10 и Hap-12) и одна из 2 особей (Hap-25), остальные из одной особи (см. рисунок на с. 44). По величине генетических различий между особями (p-дистанции) выявляются прежде всего две крупные совокупности, первая из 32 особей, вторая из 18 особей. Выделение первой совокупности объясняется тем, что в положениях № 613, № 619 и № 622 находится нуклеотид аденин (А), тогда как во второй совокупности тимин (T), гуанин (G) и цитозин (С). Две особи обладают уникальным набором нуклео- тидов, поэтому не входят ни в одну группировку (см. рисунок на с. 44 и табл. 1). Таким образом, в исследованной популяции обнаружено две совокупности особей, рельефно отличающихся по набору нуклеотидов в некоторых сайтах. Для выявления причин возникновения этого явления необходимы дополнительные исследования.

Гаплотипическое разнообразие:
Hd = 0,904 ± 0,00511

Нуклеотидное разнообразие:
π = 0,00645 ± 0,0000998.

Тест Таджимы на селективную нейтральность замен равен D = -1,6378, p > 0,05, следовательно большинство замен нуклеотидов являются синонимичными, т. е. не изменяют кодируемую кодоном аминокислоту.

Для объяснения всех возможных замен нуклеотидов предложены несколько моделей, названия которых указывают на их авторов [11; 12]. Для проверки соответствия характера реальных замен с предполагаемыми в имеющихся гипотезах (моделях) используют два теста. Первый - Байесовский информационный критерий BIC (Bayesian Information Criterion), его значения проранжи- рованы в порядке увеличения в третьем столбце табл. 2. По его значениям наиболее оптимальной является модель Хасегава- Кишино-Яно (HKY). Немногим хуже совпадение для однопараметрической модели Джукса и Кантора (JC-Jukes-Cantor).

В таблице также указаны значения информационного критерия Х. Акайке, разработанного в начале 70-х гг. XX в. По величине показателя AICc (Akaike Information Criterion, corrected )наиболее приемлема модель замен, соответствующая модели Хасегава-Кишино-Яно (табл. 2).

Определение наиболее вероятной модели мутационных замен нуклеотидов важно для корректного статистического анализа. Раннее по изучению нуклеотидной последовательности гена цитохромокси- дазы без проверки использовали модель Кимура 2 (К2 ) [13].

Ранее выборка звездчатой камбалы послужила для определения генетического разнообразия другого гена мтДНК - цито- хромоксидаза субъединица 1 [1] . У 35 особей звездчатой камбалы, пойманной в том же месте, что и особи, исследованные в данной работе, обнаружено 13 полиморфных сайтов (ps = 13/669 = 0,01943). Гаплотипическое разнообразие Hd = 0, 7616 ± 0,0199, нуклеотидное разнообразие р = 0, 00224 ± 0, 0000575. Генетическое разнообразие гена цитохромоксидазы мтДНК почти в 2 раза меньше, чем аналогичная величина для гена цитохром b. Такой результат подтверждает ранее отмеченный у других видов рыб такой же характер варьирования уровня генетического разнообразия некоторых генов мтДНК. По этой причине признано, что для целей видовой идентификации рыб следует использовать малоизменчивый ген цитохром- оксидазы [15; 16].

Более изменчивый ген цитохром b более полезно использовать для популяционно- генетических работ, как это нами сделано для другого вида - желтоперой камбалы (Limanda aspera) [17].

Помимо чисто научного значения, определение величины генетического разнообразия двух локусов мтДНК промышляемой популяции звездчатой камбалы важно для генетического мониторинга. Задача генетического мониторинга - следить за состоянием популяции, в случае резкого снижения уровня генетического разнообразия следует предложить меры по его сохранению. По современным теоретическим положениям в популяции необходимо поддерживать оптимальный уровень генетического разнообразия [5]. Конкретно для исследованной популяции крайне важно сохранить обе совокупности самок, отличающиеся по нуклеоти- дам в некоторых сайтах. Изучение изменчивости, прежде всего генов мтДНК, для камбал имеет важное значение, поскольку эти гены в митохондриях передаются самками в икринки и выросшие из них потомки-самки опять передают их далее через икринки самкам. Скорее всего, именно самки (точнее гены мтДНК) позволяют более точно определить генетическое разнообразие конкретной популяции звездчатой камбалы, размножающейся на каком-то участке прибрежья Тауйской губы.

Полиморфные сайты в исследованном фрагменте гена цитохрома b мтДНК звездчатой камбалы (5 ... 313)

Примечание. Обозначения нуклеотидов: А - аденин, G - гуанин, Т-тимин и С - цитозин.

Таблица 2
Значения статистических показателей для проверки моделей замен нуклеотидов во фрагменте гена цитохром b мтДНК у звездчатой камбалы

Дендрограмма р-дистанций, найденных по частотам нуклеотидов гена цитохром b , для особей звездчатой камбалы Тауйской губы, Охотское море
 

Библиографический список

1. Пустовойт С.П. О моделях замен нуклеотидов во фрагменте гена субьединицы 1 цитохромоксидазы мтДНК у звездчатой камбалы (Platichthys stellatus) / С.П. Пустовойт, Р.Р. Юсупов // Вестник Сев.-Вост. гос. у-нт. - 2016. - Вып. 25. - С. 58-64.
2. Юсупов РР Размножение и развитие звездчатой камбалы Platichthys stellatus (Pleuronectidae) Тауйской губы (северная часть Охотского моря) / Р.Р. Юсупов // Известия ТИНРО. - 2011. - Т. 166. - С. 38-53.
3. Юсупов РР Распределение и биологическая структура камбаловых рыб (Pleuronectidae) в северной части Охотского моря / РР Юсупов [и др.] // Вестник Сев.-Вост. науч. центра ДВО РАН. - 2016. - № 4. - С. 72-88 .
4. Дьяков Ю.П. О распределении промысловых видов камбал в водах Западной Камчатки / Ю.П. Дьяков, Н.П. Дьякова // Вестник Камчат. гос. техн. ун-та. - 2009. - № 9. - С. 42-54.
5. An H.S. Genetic diversity and differentiation of the Korean starry flounder (Platichthys stellatus) between and within cultured stocks and wild populations inferred from microsatellite DNA analysis / H.S. An [et al.] // Molecular Biology Report. - 2014. - Vol. 41. - № 11. - P. 7281-7293.
6. Алтухов Ю.П. Внутривидовое генетическое разнообразие: мониторинг и принципы сохранения / Ю.П. Алтухов // Генетика. - 1995. - Т. 31. - № 10. - С. 1333-1357.
7. Тетушкин Е.Я. Ландшафтная и экологическая геномика / Е.Я. Тетушкин // Генетика. - 2013. - Т. 49. - № 10. - С. 1133-1148.
8. Kartavtsev Y.P. Cytochrome b (Cyt -b) gene sequence analysis in six flat fish species (Teleostei, Pleuronectidae), with phylogenetic and taxono- mic insights / Y.P. Kartavtsev [et al.] // Marine Biology. - 2007. - Vol. 152. - P. 757-773.
9. Tamura K. MEGA6: Molecular evolutionary genetics analysis version 6.0. / K. Tamura [et al.] // Molecular Biology and Evolution. - 2013. - Vol. 30. - P. 2725-2729.
10. Librado P. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data / P. Librado, J. Rozas // Bioinformatics. - 2009. - Vol. 25. - P. 14511452.
11. Лукашов В.В. Молекулярная эволюция и филогенетический анализ / В.В.Лукашов. - М. : БИНОМ. Лаборатория знаний, 2009. - 256 с.
12. Ней М. Молекулярная эволюция и филогенети- ка / М. Ней, С. Кумар. - Киев : КВ1Ц, 2004. - 421 с.
13. Ward R.D. DNA barcoding Australia's fish species / R.D. Ward [et al.] // Philosophical Transactions of the Royal Society. B. - 2005. - Vol. 360. - P. 1847- 1857.
14. Шнеер В.С. ДНК-штрихкодирование видов животных и растений - способ их молекулярной идентификации и изучения биоразнообразия/ B. С. Шнеер // Журнал обшей биологии. - 2009. - Т. 70. - № 4. - С. 296 -315.
16. Пустовойт С.П. ДНК штрих-кодирование хоботной камбалы (Myzopsetta proboscidea) из Тауйской губы, Охотское море / С.П. Пустовойт, Р.Р. Юсупов // Генетика и разведение животных. - 2016. - № 4. - C. 42-46.
17. Пустовойт С.П. Генетическая дифференциация желтоперой камбалы (Limanda aspera) Тауйской губы, выявленная по нуклеотидным последовательностям фрагмента гена цитохрома b мтДНК / С.П. Пустовойт, Р.Р. Юсупов // Известия ТИНРО. - 2015. - Т. 183. - С. 89-96.

Источник: Научный журнал "Вестник Северо-Восточного государственного университета" 2018. - Вып. 29.


Категория: Животные. Зоотехника | Добавил: x5443 (08.06.2019)
Просмотров: 13 | Теги: камбала, Охотское море | Рейтинг: 0.0/0
Всего комментариев: 0
Добавлять комментарии могут только зарегистрированные пользователи.
[ Регистрация | Вход ]
...




Copyright MyCorp © 2019 Обратная связь