Пятница, 09.12.2016, 16:30
Высшее образование
Приветствую Вас Гость | RSS
Поиск по сайту


Главная » Статьи » Естественные науки

О МОДЕЛЯХ ЗАМЕН НУКЛЕОТИДОВ ВО ФРАГМЕНТЕ ГЕНА СУБЪЕДИНИЦЫ 1 ЦИТОХРОМОКСИДАЗЫ МТДНК У ЗВЕЗДЧАТОЙ КАМБАЛЫ (PLATICHTHYS STELLATUS)

С.П.Пустовойт, Р.Р.Юсупов

О МОДЕЛЯХ ЗАМЕН НУКЛЕОТИДОВ ВО ФРАГМЕНТЕ ГЕНА СУБЪЕДИНИЦЫ 1 ЦИТОХРОМОКСИДАЗЫ МТДНК У ЗВЕЗДЧАТОЙ КАМБАЛЫ (PLATICHTHYS STELLATUS)

Приводится первое описание нуклеотидных последовательностей гена субъединицы 1 цитохромоксидазы (СО/) митохондриальной ДНК звездчатой камбалы из Тауйской губы, Охотское море. В последовательностях 35 особей выявлено 13 полиморфных сайтов, гаплотипическое разнообразие равно Hd = 0,7616 ± 0,01099. Величина генетического разнообразия гена цитохромоксидазы звездчатой камбалы из Охотского моря, оцененной по нашим данным, меньше, чем у особей из Берингова и Чукотского морей, найденная по литературным сведениям. Наиболее адекватными для объяснения характера замен нуклеотидов являются модели Джукса-Кантора и Кимура2.

Ключевые слова: звездчатая камбала, субъединица 1 цитохромоксидаза мтДНК, Охотское море.

 

Звездчатая камбала (Platichtys stellatus, Pleuronectidae, Pleuronectiformes) обитает в морях восточного сектора Северного Ледовитого океана и северной части Тихого океана. В Охотском море данный вид распространен повсеместно [1; 2], но по численности выловах звездчатая камбала уступает желтоперой.

Рациональная эксплуатация запасов звездчатой камбалы подразумевает учет по- пуляционной структуры вида. Популяционно- генетические исследования звездчатой камбалы только начинаются и в настоящее время оценивается генетическая изменчивость генов митохондриального генома (мтДНК). Среди генов мтДНК животных в целом и рыб в частности для целей видовой идентификации предложено использовать ген цитохром оксидазы субъединицы 1 (COl или coxl). Показано, что для надежной видовой идентификации достаточно фрагмента этого гена (до 700-800 пар нуклеотидов), который достаточно легко амплифицируется с помощью стандартных праймеров [3-5]. Специально созданные банки данных накапливают информацию о видовых наборах нуклеотидов, предоставление такой информации исследователями происходит на добровольной и безвозмездной основе. В настоящее время в специализированном банке по штрихкоди- рованию (The Barcode Library, www.boldsys- tems.org) и в Генетическом банке (GenBank, www. ncbi. nlm.nih.gov) имеется информация о 33 нуклеотидных последовательностях гена цитохромоксидазы у звездчатой камбалы. Указанные банки данных постоянно пополняются, поэтому к моменту публикации работы количество секвенсов может измениться. В указанных банках содержится информации о нуклеотидной последовательности гена цитохромоксидазы от особей, отловленных за пределами Охотского моря. Нами показано, что у особей таких видов, как желтоперая камбала [6; 7], полосатая камбала [8] и тихоокеанский палтус [9], отловленных в Охотском море, обнаружены новые варианты нуклеотидных наборов, не указанные ранее.

Цель данной работы - проанализировать нуклеотидные последовательности фрагмента гена цитохромоксидазы субъединицы 1 у звездчатой камбалы Охотского моря.

Материалы и методы

Особи звездчатой камбалы отловлены в июле 2012 г. в прибрежье Тауйской губы в районе бывшего пос. Янский. Пробы мышц хранились в замороженном состоянии.

Из мышц особей выделяли ДНК по стандартной методике [6]. Секвенирование ну- клеотидной последовательности гена цито- хромоксидазы выполнено в ЗАО «Синтол», г. Москва. Для полимеразной цепной реакции использованы следующие праймеры [10]: VF1 5TTCTCAACCAACCACAAAGACATTGG3', VR1 5TAGACTTCTGGGTGGCCAAAGAAT CA3'. Последовательности фрагмента гена мтДНК были выравнены при помощи программы ClustalW, входящей в пакет MEGA 6.0 [11]. Для конструирования дендрограмм использовали р-дистанции, метод кластеризации для построения дендрограмм - невзвешанный попарно-групповой (UPGMA). Показатели гаплотипического и нуклеотидного разнообразия, а также теста Таджимы подсчитывали при помощи программы статистической программы DnaSP [12].

Результаты

Исследуемый фрагмент гена у всех 35 особей состоит из 669 нуклеотидов. Выбранная нами одинаковая длина всех секвенсов позволяет корректно сравнивать их между собой. Обнаружено 13 полиморфных сайтов, что определяет величину их доли ps= 13/ 669 = 0,01943. Самый изменчивый сайт № 540, где обнаружено 17 замен (р540 = 0,4857), следующий № 102 (р102 = 0,1429), далее № 168 (р168 = 0,0857), все прочие сайты обнаружили только один вариант замен. Из 35 случаев изменчивости в 13 полиморфных сайтах имеется 31 транзиция и 4 трансверсии, т. е. отношение R = 31/4 = 7,75. Как и полагается, частота замена пурина на пурин (аденина A на гуанин G) или пиримидина на пиримидин (цитозина C на Тимин T), т. е. транзиций более высока, чем замена пурина на пиримидин (например, аденин A на цитозин C), т. е. трансверсий. Дисперсия равна V(R) = R2 (1/nP +1/nQ) = 7,752 (1/31 + 1/4) = 2,1875, статистическая ошибка s=V(2,1875/35)=0,2837. Таким образом, R = 7,75 ± 0,369.

Обнаружено 11 гаплотипов.

Первая гаплотипическая группа состоит из 16 особей (2PS-COI-15, 7PS-COI-15, 9PS-COI-15, 11PS-COI-15, 12PS-COI-15, 14PS-COI-15, 16PS-COI-15, 17PS-COI-15, 18PS-COI-15, 19PS-COI-15, 21PS-COI-15, 23PS-COI-15, 26PS-COI-15, 29PS-COI-15, 33PS-COI-15, 49PS-COI-15);
вторая группа из 6 особей (3PS-COI-15, 4PS-COI-15, 6PS-COI-15, 27PS-COI-15, 28PS-COI-15, 40PS-C0I-15);
третья группа из 4 особей (5PS-COI-15, 24PS-COI-15, 39PS-COI-15, 44PS-COI-15);
четвертая группа из 2 особей (13PS-COI-15, 22PS-COI-15), в остальных группах по одной особи в соответствии с распределением особей по гаплотипическим группам получаются четыре кластера, три особи не включаются ни в один кластер (см. рис. на с. 61).

Гаплотипическое разнообразие Hd= 0,7616, среднее квадратическое отклонение 0,065, поэтому статистическая ошибка 0,065/V35= 0,01099, Hd = 0,7616 ± 0,01099. Нуклеотидное разнообразие p=0,00224, среднее квадратическое отклонение 0,00034, статистическая ошибка 0,00034/V35=0,0000575, я=0,00224± 0,0000575.

Тест Таджимы на селективную нейтральность замен D = -1,6809, p > 0,05. Данный тест показывает, что большинство замен нуклеотидов являются синонимичными, т. е. не изменяют кодируемую кодоном аминокислоту.

Для корректного сравнения нуклеотид- ных последовательностей исследованных нами и имеющихся в Генетическом банке (Gen Bank) выбрана одинаковая длина последовательностей. Отметим, что часть секвен- сов из Генетического банка короче, чем исследованные нами, что, возможно, несколько искажает полученные оценки. Для 33 секвенсов, отобранных из Генетического банка, число полиморфных сайтов s=21, р5=0,036972, 14 гаплотипов. Генетическое разнообразие следующее: нуклеотидное разнообразие p=0,00715±0,000011 и гаплотипическое разнообразие 0,847±0,0091. Имеющиеся в Генетической базе секвенсы показывают уровень изменчивости в 3 раза выше, чем для изученных в нашем исследовании. Указанная разница объясняется скорее всего следующей причиной. Исследованная нами выборка получена из одной локальности Охотского моря, тогда как сравниваемыми нами литературные данные получены от особей из разных участков ареала звездчатой камбалы. К сожалению, указанная информация не всегда указывается в Генетическом банке. Следовательно, есть заметные отличия в нуклеотидных последовательностях у особей, отловленных в географически изолированных выборках.
Для объяснения всех возможных замен нуклеотидов предложено несколько моделей, названия которых указывают на ее автора [13; 14]. Рассмотрим, какая модель подходит для объяснения генетического разнообразия в нашем случае.
 
Для проверки совпадимости характера реальных замен с предполагаемыми в имеющихся гипотезах (моделях) используют два теста. Данные тесты реализованы в программе MEGA в модуле максимально вероятностного теста (Maximum Likelihoodfits). Первый - байесовский информационный критерий BIC (Bayesianlnformation Criterion), его значения проранжированы в порядке увеличения в третьем столбце табл. 2 на с. 64. Байесовский информационный критерий предложен Шварцем в 1978 г. По его значениям наиболее оптимальной является модель, предложенная Джуксом и Кантором (JC, Jukes-Cantor). Немногим хуже совпадение для двухпараметрической модели Кимуры (K2, Kimura 2-parameter). Видоизменения модели Джукса и Кантора (JC + I и JC + G и JC + G + I) дают худшее совпадение с оригинальной моделью (JC). Аналогичная закономерность с вариациями двухпараметрической модели Кимуры (K2 + 1 и K2 + G). Далее наиболее близка по величине BIC трехпараметричес- кая модель Тамуры (T92, Tamura 3-parameter), далее по величине показателя BIC располагается модель Хасегавы-Кишино- Яно. Мы выбрали величины в первой десятке списка, поскольку все прочие показывают крайне слабое совпадение экспериментальных замен и расчетных.

В таблице указаны значения информационного критерия Х. Акайке, разработанного в начале 70-х гг. XIX в. Позже Суигара видоизменил его в скорректированный критерий (AlCc) для учета влияния численности выборок. По величине показателя AlCc (Akaike Information Criterion, corrected) наиболее приемлема модель замен, предложенная Хасегавы-Кишино-Яно, затем К2. По сути, различия между ними по рассматриваемому параметру незначительны.

Модель Джукса-Кантора предложена раньше всех и является однопараметрической [13; 14]. Согласно ей, вероятность (или частота) замены любого нуклеотида за единицу времени одинакова и обозначена а. В отличие от нее модель Кимуры (К2) является двухпараметрической, поскольку частота транзиций (сi) обычно больше, чем трансверсий (Р) (как и в нашем исследовании). Для каждого нуклеотида возможна одна транзиция и две трансверсии. По значениям показателя BIC расчеты для этих моделей различаются незначительно, поскольку, видимо, разная частота трансверсий и транзиций не оказывает особого влияния. Более существенно отличается от рассмотренных модель Тамуры (Т92), автор предложил учитывать содержание нуклеотидов G и C (GC-содержание). В двойной цепочке ДНК нуклеотиды G и C соединены тремя связями, тогда как нуклеотиды A и T - двумя. Данные различия могут иметь значение для частоты образования замен. Авторы последней модели, имеющейся в таблице Хасегава- Кишино-Яно (HKY, Hasegawa-Kishino-Yano), учитывают неодинаковую реальную частоту каждого нуклеотида в качестве фактора, меняющего частоту трансверсий и транзиций. По результатам расчетов из таблицы видно, что наиболее подходящими для объяснения характера замен нуклеотидов являются модели Джукса-Кантора и Кимура2. В первых работах по изучению нуклеотидной последовательности гена цитохромокси- дазы без проверки использовали модель К2 [4; 5].

Данная статья описывает генетическую изменчивость гена цитохромоксидаза субъединицы 1 мтДНК у нового вида камбал из Охотского моря. Ранее опубликованы аналогичные сведения для других видов камбал [6-8] и палтуса [9]. Выбор этого гена в качестве видоспецифического произошел не сразу, на первых этапах активно использовали рибосомные гены 12S и 16S [15]. Сейчас описывают полный митохондриальный геном разных видов камбал [16; 17]. Однако для целей видовой идентификации вполне достаточно гена цитохромоксидазы, что показано в многочисленных публикациях [5; 18].

Дендрограмма р-дистанций для особей звездчатой камбалы Тауйской губы, Охотское море
 

Таблица 1
Полиморфные сайты в исследованном фрагменте гена цитохромоксидазы субъединицы 1 мтДНК

 
 

Таблица 2
Значения статистических показателей для проверки моделей замен нуклеотидов во фрагменте гена цитохромоксидазы у звездчатой камбалы

 
Библиографический список

1. Колпаков Н.В. Особенности биологии звездчатой камбалы Platichthys stellatus (Pleuronectidae) прибрежных вод северного Приморья / Н.В. Колпаков // Вопросы ихтиологии. - 2005. - Т. 45. - № 5. - С. 625637.
2. Юсупов Р.Р. Размножение и развитие звездчатой камбалы Platichthys stellatus (Pleuronectidae) Тауйской губы (северная часть Охотского моря) / Р.Р. Юсупов // Известия ТИНРО. - 2011. - Т. 166. - С. 38-53.
3. Шнеер В.С. ДНК-штрихкодирование видов животных и растений - способ их молекулярной идентификации и изучения биоразнообразия / В.С. Шнеер // Журнал обшей биологии. - 2009. - Т. 70. - № 4. - С. 296-315.
4. Ward R.D. DNA barcoding Australia's fish species / R.D. Ward [ ] // Philosophical Transactions of the Royal Society. B. - 2005. - Vol. 360. - P. 1847-1857.
5. Ward R.D. The campaign to DNA barcode all fishes, FISH-BOL / R.D. Ward, R. Hanner, P.D.N. Hebert // Journal of Fish Biology. - 2009. - Vol.74. - № 2. - P. 329-356.
6. Пустовойт С.П. О нуклеотидной последовательности гена цитохромоксидаза СО-1 митохондриаль- ной ДНК желтоперой камбалы (Limanda aspera) Тауйской губы / C/G/ Пустовойт, Р.Р. Юсупов // Вестник СВГУ. - 2012. - Вып. 17. - С. 49-58.
7. Пустовойт С.П. Полиморфизм фрагментов митохондриальной ДНК у желтоперой камбалы Limanda aspera, Pallas (1814) из Тауйской губы Охотского моря / С.П. Пустовойт и [др.] // Вестник СевероВосточного научного центра ДВО РАН. - 2014. - № 1. - С. 85-88.
8. Потапова Н.А. Анализ нуклеотидных последовательностей гена цитохромоксидазы 1 (СО1) мтДНК полярной Liopsetta glacialis и Liopsetta pinnifasciata полосатой камбал (Pleuronectidae) Охотского моря / Н.А. Потапова, С.П. Пустовойт, Р.Р. Юсупов // Цитология и генетика. - 2014. - Т. 48. - № 6. - С.11-16.
9. Пустовойт С.П. Анализ изменчивости нуклео- тидной последовательности фрагмента гена цито- хромоксидазы 1 мтДНК у тихоокеанского белокорого палтуса (Hippoglossus stenolepis) Охотского моря / С.П. Пустовойт, Р.Р. Юсупов, А.И. Каика // Исследования водных биологических ресурсов Камчатки и Северо-Западной части Тихого океана. - 2015. - Вып. 36. - С. 25-33.
10. Ivanova N.V. Universal primer cocktails for fish DNA barcoding / N.V. Ivanova [et al.] // Molecular Ecology Notes. - 2007. - Vol.7. - C. 544-548.
11. Tamura K. MEGA6: Molecular evolutionary genetics analysis version 6.0. / К. Tamura [et al.] // Molecular Biology and Evolution. - 2013. - № 30. - P. 2725-2729.
12. Librado P. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data / Р. Librado, J. Ro- zas // Bioinformatics. - 2009. - 25. - P. 1451-1452.
13. Лукашов В.В. Молекулярная эволюция и филогенетический анализ / В.В. Лукашов. - М. : БИНОМ. Лаб. знаний, 2009. - 256 с.
14. Ней М. Молекулярная эволюция и филогенети- ка / М. Ней, С. Кумар. - Киев : КВ1Ц, 2004. - 421 с.
15. Berendzen P.B. Phylogenetic relationships of Pleuronectiformes based on molecular evidence / Р.В. Berendzen, W.W. Dimmick // Copeia. - 2002. - Vol. 3. - P. 642- 652.
16. Shi W. Complete mitogenome sequences of four flatfishes (Pleuronectiformes) reveal a novel gene arrangement of L-strand coding genes / W. Shi // BMC Evolutionary Biology. - 2013. - Vol. 13.-173. - P. 1-9.
17. Mjelle K.A. Halibut mitochondrial genomes contain extensive heteroplasmic tandem repeat arrays involved in DNA recombination / К.А. Mjelle [et al.] // BMC Genomics. - 2008. - Vol. 9. -P. 1-11.
18. Шарина С.Н. Филогенетический анализ камбал (Teleostei, Pleuronectiformes), основанный на исследовании нуклеотидных последовательностей гена цитохромоксидазы (СО-1) / С.Н. Шарина, Ю.Ф. Картавцев // Генетика. - 2010. - Т. 46. - № 3. - С. 401-407.
 

Вестник Северо-Восточного государственного университета
Магадан 2016. Выпуск 25

Категория: Естественные науки | Добавил: x5443 (13.07.2016)
Просмотров: 82 | Теги: звездчатая камбала | Рейтинг: 0.0/0
Всего комментариев: 0
Добавлять комментарии могут только зарегистрированные пользователи.
[ Регистрация | Вход ]
...




Copyright MyCorp © 2016