Воскресенье, 04.12.2016, 17:11
Высшее образование
Приветствую Вас Гость | RSS
Поиск по сайту


Главная » Статьи » Естественные науки

ДНК-ШТРИХКОДИРОВАНИЕ ПОЛЯРНОЙ КАМБАЛЫ LIOPSETTA GLACIALIS

Н.А.Потапова, С.П.Пустовойт, Р.Р.Юсупов

ДНК-ШТРИХКОДИРОВАНИЕ ПОЛЯРНОЙ КАМБАЛЫ LIOPSETTA GLACIALIS

Впервые определена нуклеотидная последовательность гена цитохромоксидазы субъединицы 1 митохондриальной ДНК10 особей полярной камбалы Охотского моря. Выявлено шесть гаплотипов, средняя величина р-дистанций для 10 особей 0,0037.

Ключевые слова: полярная камбала, цитохромоксидаза субъединицы 1 мтДНК, Охотское море.

 
Полярная камбала (Liopsetta glacialis) - один из видов малоротых камбал семейства камбаловых (Pleuronectidae, Pleuronectiformes).

Распространена в прибрежных морях Северного Ледовитого океана, а также в северной части Тихого океана (Берингово и Охотское моря) [6; 7]. Название «полярная» указывает на то, что это самая холодолюбивая камбала. Южная граница расселения неизвестна. В Северном Ледовитом океане В. К. Есиповым [2] были выделены 3 подвида, однако А.Н. Андрияшев [1] справедливо указывал на невысокий уровень различий в морфологических признаках, использованных Есиповым для описания подвидов.

В связи с низкой численностью в северной части Охотского моря и небольшими размерами полярная камбала не относится к ценным видам дальневосточных камбал и промышляется только в виде прилова, главным образом при промысле наваги в зимний период.

Современных работ, посвященных биологии полярной камбалы дальневосточных морей очень немного [10; 11]. Систематика полярной камбалы также не полностью ясна. Согласно современной номенклатуре Дж. Нельсона [3] полярная камбала, как и все виды рода Liopsetta, включены в род Pleuronectes. В то же время отечественные исследователи всегда выделяли полярных камбал в отдельный род Liopsetta, включающий четыре вида [1; 4; 6; 7].

Для решения спорных вопросов систематики рыб в последнее время популярны работы, анализирующие нуклеотидные последовательности ядерных или митохондриальных генов. Более десяти лет назад начато выполнение международной программы, получившей название ДНК-штрихкодирова- ние видов(International BarcodeofLife Project, IBOL), предложено для всех видов животных использовать ген цитохромоксидазы субъединицы 1 митохондриальной ДНК [9]. В силу невысокой изменчивости он оказался очень- удобен для описания видовых особенностей в последовательностях нуклеотидов. Международная база данных (http: // ibol.org) на добровольной основе постоянно пополняется, на начало 2013 г. она включала нуклеотидные последовательности для 76 видов семейства камбаловых (Pleuronectidae), для полярной камбалы сведений нет. В более обширной базе данных, пополняемой последовательностями всех генов (http://www. ncbi.nlm.- nih.gov), также нет указаний на исследования данного вида.

Цель работы - описать нуклеотидную последовательность гена цитохромоксидазы полярной камбалы, обитающей в Тауйской губе, Охотское море.

Материалы и методы
Пробы мышц 10 особей полярной камбалы собраны в феврале 2012 г. в Тауйской губевблизи о-ва Шеликан во время промышленного лова наваги. Особи обозначены:
1-я проба - P2LG12, 2-я - P3LG12, 3-я - P4LG12, 4-я - P6LG12, 5-я - P7LG12, 6-я - P8LG12, 7-я - P9LG12, 8-я - P10LG 12, 9-я - P13LG12, 10-я - P14 LG12. В обозначении проб указан номер особи в выборке, например, Р2 - вторая особь, LG - по латинскому названию вида, последние 2 цифры обозначают год поимки.

Митохондриальную ДНК выделяли из замороженных кусочков мышц по стандартной методике [5; 14]. Секвенирование нуклеотид- ной последовательности гена цитохромоксидазы 1было произведено в ОАО «Синтол», г. Москва. Для полимеразно-цепной реакции (ПЦР) были использованы праймеры: FishF1 5'TCAACCAACCACAAAGACATTGGCAC3', FishR1 5'TAGACTTCTGGGTGGCCAAA- GAATCA3' [8; 13].

Из двух антипараллельных последовательностей конструировали одну консен- сусную и ее выравнивали программой CrustalW, входящей в пакет MEGA5.0. [15]. Статистическая обработка данных проведена с помощью этой же программы. Рассчитывали p-дистанции попарно между всеми последовательностями, по полученной матрице конструировали дендрограмму методом попарного внутригруппового невзвешенного среднего (UPGMA).

Результаты и обсуждение
Нуклеотидные последовательности приведены в табл. 1 на с. 86. Поясним, что показана полная последовательность нуклеотидов только для первого образца (P2 LG 12), у остальных показаны только отличные от него сайты. Общая для всех проб длина последовательности 595 или 596 нуклеотидов. Разница связана с наличием у некоторых особей делеции в положение 24 (табл.1). Приведенные в табл. 2 на с. 89 частоты нуклеотидов показывают, что во всех пробах количество аденина (A) стабильно и составляет 15,5 %, тогда как количество цитозина (C) варьирует в сравнительно широких пределах - от 30, 2 до 30,7 %. Изменчивость частот гуанина (G) и тимина (T) меньше, чем цитозина.

Величины попарных р-дистанций (табл. 3 на с. 90) и структура построенной по ним ден- дрограммы (см. рисунок на с. 89) указывает высокую степень отличия от остальных пробы P4LG12. Причина этого - наличие двух уникальных (для данной выборки) транзиций в положении № 547 C® T и № 549 G® A (табл. 4 на с. 90), кроме того есть более часто встречающиеся и у других особей две трансверсии (G ® C) в положении № 519 и № 591. Довольно своеобразен нуклеотид- ный состав пробы P2LG12, так как только в данной последовательности в позиции № 591 G тогда как у всех С (трансверсия).
 
Идентичный нуклеотидный состав имеют пробы P6 LG 12, P7LG 12, P8LG12 и P10LG12, поэтому они образуют основу первого кластера. Основу второго кластера составляют пробы P9LG12 и P14LG12, которые полностью совпадают между собой по составу нуклеотидов. Всего можно выделить шесть наборов нуклеотидных последовательностей (гаплотипов):
1 гаплотип включает пробу Р2LG12; 2 - Р3LG12; 3 - Р4LG12; 4 - Р6LG12, Р7LG12, Р8LG12, Р10LG12; 5 - Р9LG12 и Р14LG12; 6 - Р13LG12. Среднее для всех особей значение р-дистанции равно 0,0037, столь низкая величина изменчивости соответствует обычным величинам при сравнении особей одного вида [9]. Всего обнаружено 6 вариабельных сайтов, поэтому величина ps=s/m=6/595=0,0101, нуклеотидное разнообразие п=0,003 697.

В рамках глобального проекта ДНК- штрихкодирования видов животных и растений в 2005 г. выделена программа, посвященная рыбам (Fish Barcode of Lifelnitiative, FISH- BOL) [16; 17]. К июлю 2011 г из около 31 тысячи видов рыбообразных и рыб известна нуклеотидная последовательность гена цитохромоксидазы для 25 % видов, а для отряда камбалообразных - 30,2 % [12]. Более 88 % видов рыб просеквенированы в Институте Биоразнообразия, Канада (Biodiversity Instituteof Ontario, BIO). По этой причине подавляющее число исследованных особей камбал (как и прочих видов рыб) поймано в морях за пределами российских границ, поэтому для полярной камбалы из вод российского побережья таких сведений до настоящего времени не было.

Проведенные нами исследования позволили впервые для полярной камбалы, обитающей в водах российского побережья, установить нуклеотидные последовательности гена цитохромоксидазы мтДНК, что представляется важным не только для последующих филогенетических исследований камбал. Накопление геногеографической информации позволит уточнить границы ареала исследуемого вида.

Таблица 1

 
 
Таблица 2
Частота (%) нуклеотидов в последовательностях гена цитохромоксидаза полярной камбалы Liopsetta glacialis

Примечание: Т - тимин, С - цитозин, А - аденин, G - гуанин, n - общее число нуклеотидов
 

Дендрограмма генетических различий, построенная по р-дистанциям между нуклеотидными последовательностями гена цитохромоксидазы 10 особей полярной камбалы

Таблица 3

Таблица 4

 
 

Библиографический список

1. Андрияшев А.П. Рыбы северных морей СССР. - М.-Л. : Изд-во АН СССР, 1954. - 566 с.
2. Есипов В.К. Рыбы Карского моря. - М. : Изд-во АН СССР, 1952. - 146 с.
3. Нельсон Д.С. Рыбы мировой фауны. - М. : Книжный дом «Либроком», 2009. - 880 с.
4. Промысловые рыбы России: в 2 т. / под ред. О.Ф. Гриценко, А.Н. Котляра и В.Н. Котенева. - М. : Изд-во ВНИРО, 2006. - 1280 с.
5. Пустовойт С.П. О нуклеотидной последовательности гена цитохромоксидаза СО-1 митохондриаль- ной ДНК желтоперой камбалы (Limanda aspera) Та- уйской губы / С.П. Пустовой, Р.Р. Юсупов // Вестн. Сев.- Вост. гос. ун-та.- 2012. - Вып. 17. - С.49-58.
6. Фадеев Н.С. Северотихоокеанские камбалы, распределение и биология. - М. : Наука, 1987. - 174 с.
7. Фадеев Н.С. Справочник по биологии и промыслу рыб северной части Тихого океана. - Владивосток : ТИНРО-центр, 2005. - 366 с.
8. Шарина С.Н. Филогенетический анализ камбал (Teleostei, Pleuronectiformes), основанный на исследовании нуклеотидных последовательностей гена цитохромоксидазы 1 (СО-1) / С.Н. Шарина, Ю.Ф. Картав- цев // Генетика. - 2010. - Т. 46. - № 3. - С. 401-407.
9. Шнеер В.С. ДНК-штрихкодирование видов животных и растений - способ их молекулярной идентификации и изучения биоразнообразия // Журн. общей биологии. - 2009. - Т. 70. - № 4. - С. 296-315.
10. Юсупов Р.Р. Морфо-биологическая характеристика полярной камбалы Liopsetta glacialis (Pleuronectidae, Pleuronectiformes) Тауйской губы (северная часть Охотского моря) / Р.Р. Юсупов, И. Д. Басов // Вестн. СВНЦ ДВО РАН. - 2005. - № 2. - С.48- 55.
11. Юсупов Р.Р. Эмбрионально-личиночное развитие полярной камбалы Liopsetta glacialis (Pleuronectidae) Тауйской губы (северная часть Охотского моря) // Известия ТИНРО. - 2010. - T. 162. - С.179-193.
12. Becker S., Hanner R., Steinke D. Five years of FISH-BOL: Brief status report // Mitochondrial DNA. - 2011. - 22(S1). - P. 3-9.
13. Kartavtsev Y.P., Sharina S.N., Goto T., Chich- varkhin A.Y., Balanov A.A., Vinnikov K.A., Ivankov V.N., HanzawaN. Cytochrome oxidase 1 gene sequence analysis in six flatfish species (Teleostei, Pleuronectidae) of Far East Russia with inferences in phylogeny and taxonomy // Mitochondrial DNA. - 2008. - 19(6). - P. 479489.
14. Sambrook J.F., Fristch E.F., Maniatis T. Molecular cloning: a laboratory manual. - N.Y. : Cold Spring Harbor Lab. Press. - 1989. - 2nd ed. - 1626 p.
15. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. 2011 // www. megasoftware.net
16. Ward R.D., Zemlak T.S., Innes B.A., Last R.R., Hebert P.D.N. DNA barcoding Australia's fish species // Proceedings of the Royal Society of London. - 2005. - Series B. - V. 360. - № 1716. - P. 1847-1857.
17. Ward R.D., Hanner R., Hebert PDN. The campaign to DNA barcode all fishes, FISH-BOL // Journal of Fish Biology. - 2009 - V. 74. - № 2. - P. 329-356.

Вестник Северо-Восточного государственного университета
Магадан 2013. Выпуск 19

Категория: Естественные науки | Добавил: x5443 (12.11.2016)
Просмотров: 18 | Теги: камбала | Рейтинг: 0.0/0
Всего комментариев: 0
Добавлять комментарии могут только зарегистрированные пользователи.
[ Регистрация | Вход ]
...




Copyright MyCorp © 2016