Суббота, 27.05.2017, 07:22
Высшее образование
Приветствую Вас Гость | RSS
Поиск по сайту

Главная » Статьи » Естественные науки




Впервые описана изменчивость нуклеотидных последовательностей гена цитохромок- сидазы субъединицы 1 (С01)митохондриальной ДНК популяции р. Ола, Тауйская губа, Охотское море. В последовательности длиной 652 нуклеотида выявлено 8 полиморфных сайтов, гаплотипическое разнообразие равно 0,782 ± 0,195. Обнаружены две совокупности особей нерки, различающихся комбинациями наборов нуклеотидов в некоторых сайтах исследованного гена.

Ключевые слова: нерка, цитохром оксидаза субъединицы 1 мтДНК, Охотское море.

Расположенная на северном побережье Охотского моря популяция нерки (Oncor- hynchus nerka, Salmonidae) р. Ола является изолированной, поскольку на значительном протяжении прибрежья аналогичных по численности популяций нет. Имеется в виду отсутствие нерки в остальных реках Тауйской губы (Тауй, Яна и Армань) на западе и реках Ямской губы и далее на востоке. Обитание нерки в р. Ола объясняется наличием озер, пригодных для нереста производителей. Отметим, что наиболее многочисленные популяции нерки обитают в реках п-ова Камчатка и в р. Охота [1; 6].

Указанная особенность популяции привлекает внимание не только ихтиологов, но и генетиков [2; 3]. Дополнительный интерес обусловливает использование этой популяции для искусственного разведения в целях увеличения численности этого промыслового вида рода тихоокеанские лососи [5]. Генетические исследования направлены прежде всего на определение генетических особенностей ольской популяции. Перспективным направлением исследований следует признать определение нуклеотидных последовательностей митохондриальной ДНК. Для оперативного обмена информацией о последовательностях нуклеотидов разных генов создан генетический банк данных (www.ncbi. nlm.nih.gov), в котором на момент подготовки данной работы для гена цито/хром оксидаза имеются нуклеотидные последовательности для 100 особей. Указанный ген в силу его малой изменчивости считается видоспецифичным, т. е. пригодным для генетической идентификации видов рыб в рамках программы FISH-BOL по штрихкодированию фрагмента гена цитохром оксидаза митохондриальной ДНК (DNAbarcode) [7; 11]. Несмотря на внушительное количество известных секвенсов нерки, почти все они определены для особей из популяций рек Северной Америки.

Цели данной работы описание нуклеотид/ных последовательностей фрагмента гена цитохром оксидаза субъединицы 1 популяции нерки р. Ола и сопоставление параметров его генетической изменчивости с таковыми для других популяций.

Материал и методика

13 особей нерки пойманы в устье р. Ола в конце июня-начале июля 2014 г. в период анадромной миграции. Материал хранился в замороженном состоянии до лабораторного исследования. Особи обозначены: ONNER-1 -ONNER-13.

Из замороженных кусочков мышц трех особей выделяли ДНК по стандартной методике с небольшими модификациями [4]. Секвенирование нуклеотидной последовательности гена цитохром оксидазы выполнено в ЗАО «Синтол» г. Москвы. Для полимеразной цепной реакции использованы следующие праймеры [8]: VF15TTCTCAACCAACCACAAAGACATTGG3', VR1 'TAGACTTCTGGGTGGCCAAAGAATCA3'. Из пары антипараллельных последовательностей (прямой и обратной), определенных у каждой особи, для дальнейшего анализа получена одна последовательность. Последовательности ДНК были выровнены при помощи программы ClustalW, входящей в пакет MEGA6.0 [10]. Указанная программа использована для оценки величины нуклеотидных различий (р-дистанций) для конструирования дендрограмм. Метод кластеризации для построения дендрограмм невзвешенный попарно-групповой (UPGMA). Количественные параметры генетического разнообразия найдены при помощи программы DnaSP, v. 5 [9].

Результаты и обсуждение

Общая длина исследованного фрагмента гена цитохром оксидазы субъединицы 1 нерки р. Ола составила 652 нуклеотида. Поскольку полная нуклеотидная последовательность митохондриального генома известна и конкретного участка гена цитохром оксидаза тоже (www.ncbi.nlm.nih.gov), то нет необходимости здесь ее приводить. Укажем только варианты в восьмиполиморфных сайтах, обнаруженных в исследованных пробах (ONNER-1 - ONNER-13), в табл. на с. 45. Все особи делятся нанесколько кластеров (рис. 1 на с. 47). В крупный первый кластер попали особи, у которых в положение 163 гуанин (G), в положение 202 тимин (Т), в положениях 235, 541 и 547 - цитозин (С), в положение 628 - тимин (Т). Альтернативной группировкой являются особи, у которых в положении 163 аденин (А), в положении 202 цитозин (С), в положениях 235, 547 и 628 - аденин (А), в положении 541 - тимин (Т).

Эти же альтернативные комбинации нуклеотидов делят всех исследованных особей нерки на две большие группировки (рис. 2 на с. 48). Последовательности из других популяций получены из генетического банка данных NCBI (www.ncbi.nlm.nih.gov). Для корректного сравнения все последовательности ограничены одной длиной, аналогичной таковой для исследованных нами. Секвенсы, полученные из банка, обозначены в соответствии с кодами, присвоенными в этом банке. По-видимому, для нерки характерно наличие двух совокупностей, определяемых двумя указанными особенностями нукле- отидного состава мтДНК. На рис. 2 одна группировка составляет правый сектор круговой дендрограммы от особи KF278773 и далее по движению часовой стрелки до FJ999170. Вторая - левый сектор от особи KM051536 KM051532. Тест Таджимы равен D = -0,72082, p>0,1, он указывает на неселективный характер замен в полиморфных сайтах. Возможен случайный характер фиксации специфических замен во время эволюции вида. Анализ имеющейся информации не позволяет найти какую-нибудь географическую привязку отмеченных совокупностей к конкретным участкам ареала.
Другую заметную группировку составляют 24 особи, имеющие в первом положение рассматриваемой последовательности гуанин (G): KM051536, KF278755 - KM051535 (см. таблицу), тогда как все прочие цитозин (С). Причем наличие в этом положении гуанина или цитозина никак не связано с распределением нуклеотидов в двух упомянутых совокупностях. Причина появления у 24 особей необычного варианта в первом положении неясна. Все прочие варианты полиморфных сайтов встречаются с невысокой частотой, их появление скорее всего связано с мутационным процессом.

Гаплотипическое разнообразие исследованного фрагмента гена цитохромоксидазы нерки р. Ола Hd=0,782 ±0,195 (среднее значение ± стандартное отклонение). Данная величина определяется изменчивостью в 8 сайтах, ps =8/652=0,01227. Нуклеотидное разнообразие p = 0,00358 ± 0,00101.

Гаплотипическое разнообразие для всех 113 особей составило Hd = 0,766 ± 0,022. Обнаружено 20 полиморфных сайтов, ps = 20/652 = 0,03067. Нуклеотидное разнообразие p = 0,00393 ± 0,00017. Незначительный рост величины генетического разнообразия во всех 113 секвенсах по сравнению с таковыми для ольской нерки связан с обнаружением почти всех высокополиморфных сайтов у особей из исследованной популяции.

Исследованный нами фрагмент мтДНК является видоспецифическим и может использоваться для идентификации вида. В настоящее время уровень полиморфизма гена цитохром оксидазы в популяции нерки р. Ола достаточно высок, несмотря на ее невысокую численность. Для сохранения такого уровня генетического разнообразия необходимо рационально эксплуатировать данную популяцию. Однако для решения задачи генетической дифференциации рассматриваемой популяции от других необходим подбор иного генетического маркера в нуклеотидной последовательности мтДНК нерки.

Полиморфные сайты в нуклеотидной последовательности фрагмента гена цитохром оксидаза субъединицы 1 митохондриальной ДНК нерки


Рис. 1. Генетическая дифференциация особей нерки р. Ола, найденная по величинам р-дистанций по нуклеотидным последовательностям фрагмента гена цитохромоксидаза
Рис. 2. Генетическая дифференциация особей нерки, оцененная по величинам р-дистанций, по нуклеотидным последовательностям фрагмента гена цитохромоксидаза


Библиографический список

1. Волобуев В.В. Нерка - Oncorhynchus nerka (Walbaum) материкового побережья Охотского моря / B.В. Волобуев, С.Л. Марченко С.Л. // Сборник научных трудов Магаданского научно-исследовательского института рыбного хозяйства и океанографии, 2004. - Вып. 2. - С. 259-273.
2. Пустовойт С.П. Анализ морфологических различий гомо- и гетерозиготных самок и самцов горбуши Oncorhynchus gorbuscha (Walbaum) популяции р. Ола (северное побережье Охотского моря) / C.П. Пустовойт // Цитология и генетика, 2006. - Т. 40. - № 5. - С. 3-9.
3. Пустовойт С.П. Генетическая изменчивость малочисленной популяции нерки Oncorhynchus nerka (Walbaum) р. Ола (северное побережье Охотского моря / С.П. Пустовойт // Генетика, 2001. - Т. 37. - № 12. - С. 1657-1662.
4. Пустовойт С.П. О нуклеотидной последовательности гена цитохромоксидаза Со-1 митохондриаль- ной ДНК желтоперой камбалы (Limandaaspera) Та- уйской губы / С.П. Пустовойт Р.Р. Юсупов // Вестник Северо-Восточного государственного университета / Сев.-Вост. гос. ун-т. - 2012. - Вып. 17. - С. 49-58.
5. Хованский И.Е. Эколого-физиологические и биотехнологические факторы эффективности лосо- севодства / И.Е. Хованский. - Хабаровск : Хабаров. кн. из-во, 2004. - 417 с.
6.Черешнев И.А. Лососевидные рыбы Северо- Востока России / И.А. Черешнев. - Владивосток : Даль- наука, 2002. - 496 с.
7. Becker S. Five years of FISH-BOL: Brief status report / S. Becker, R. Hanner, D. Steinke // Mitochondrial DNA, 2011. - 22(S1). - P. 3-9.
8. Ivanova N.V. An inexpensive , automation-friendly protocol for recovering high-quality DNA / N.V. Ivanova, J.R. De Waard, P.D.N. Hebert // Molecular Ecology Notes, 2006. - 6. - Р. 998-1002.
9. Librado P. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data / Р. Librado, J. Rozas // Bioinformatics, 2009. - 25. - P. 1451-1452.
10. Tamura K. MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution / К. Tamura, G. Stecher, D. Peterson, А. Filipski, S. Kumar. - 2013. - 30. - P. 2725-2729.
11. Ward R.D. The campaign to DNA barcode all fishes, FISH-BOL / R.D. Ward, R. Hanner, P.D.N. Hebert // Journal of Fish Biology, 2009. - Vol. 74. - № 2. - P. 329-356.

Вестник Северо-Восточного государственного университета
Магадан 2015. Выпуск 23

Категория: Естественные науки | Добавил: x5443x (12.04.2016)
Просмотров: 184 | Теги: Нерка, цитохром оксидаза | Рейтинг: 0.0/0
Всего комментариев: 0
Добавлять комментарии могут только зарегистрированные пользователи.
[ Регистрация | Вход ]

Copyright MyCorp © 2017 Обратная связь