Вторник, 23.07.2019, 11:15
Высшее образование
Приветствую Вас Гость | RSS
Поиск по сайту



Главная » Статьи » Животные. Зоотехника

АНАЛИЗ НУКЛЕОТИДНОЙ ПОСЛЕДОВАТЕЛЬНОСТИ ФРАГМЕНТА ГЕНА ЦИТОХРОМОКСИДАЗЫ СУБЪЕДИНИЦЫ 1 МИТОХОНДРИАЛЬНОЙ ДНК СИБИРСКОГО БУРУНДУКА (TAMIAS SIBIRICUS) ОКРЕ

С.А. Аксютина, С.П. Пустовойт, кандидат биологических наук, А.В. Ямборко, кандидат биологических наук

АНАЛИЗ НУКЛЕОТИДНОЙ ПОСЛЕДОВАТЕЛЬНОСТИ ФРАГМЕНТА ГЕНА ЦИТОХРОМОКСИДАЗЫ СУБЪЕДИНИЦЫ 1 МИТОХОНДРИАЛЬНОЙ ДНК СИБИРСКОГО БУРУНДУКА (TAMIAS SIBIRICUS) ОКРЕСТНОСТЕЙ Г. МАГАДАНА

В выборках 2015 и 2016 гг. (всего 44 особи), собранных в окрестностях г. Магадана, определено генетическое разнообразие фрагмента гена цитохромоксидазы мтДНК сибирского бурундука (Tamias sibiricus). По комбинациям нуклеотидов в полиморфных сайтах получается 25 гаплотипических групп. Вероятно, обнаруженные нами замены в нуклеотидных последовательностях обусловлены селективными процессами происходящими в популяции бурундука из окрестностей г. Магадана. Нуклеотидное разнообразие гена
цитохромоксидазы мтДНК у исследованных особей сибирского бурундука составило р = 0,00646 ± 0,000178, гаплотипическое разнообразие Hd = 0,943 ± 0,00309. Выявлено увеличение генетического разнообразия выборки 2016 г. по сравнению с выборкой 2015 г. По видимому, в 2016 г. селективные процессы в исследуемой популяции способствовали увеличению частот точковых мутаций в исследуемом фрагменте гена цитохромоксидазы мтДНК, что и привело к росту генетического разнообразия. Вместе с тем, не исключено влияние миграции особей из других локальностей. Величины генетического разнообразия выборки особей сибирского бурундука, отловленного в окрестностях г. Магадана, аналогичны этим же показателям для особей, отловленных в других участках ареала.

Ключевые слова: сибирский бурундук, цитохром оксидаза мтДНК, генетическое разнообразие.

 

Бурундуки - род грызунов из семейства беличьих (Sciuridae). К бурундукам относится 25 видов, большинство из которых обитает в Северной Америке, за исключением одного евразийского вида - сибирского бурундука (Tamias sibiricus). Сибирский бурундук населяет различные типы лиственничников обычно с подлеском из кедрового стланика и ягодных кустарников и кустарничков. Он распространен от Урала на востоке до побережья Тихого океана на западе [1]. На Северо-Востоке России его ареал ограничен лиственничной тайгой и тундрой, но в бассейне Анадыря и в Корякском нагорье по долинам рек проникает в зону тундроле- сья [2]. В последние десятилетия бурундук расселился через Парапольский дол до р. Палана на западном побережье п-ова Камчатка. Есть мнение, что на Северо-Востоке России обитает подвид - якутский бурундук [2; 3]. В окрестностях г. Магадана бурундук является постоянным обитателем лесных биотопов [4].

Актуальность работы обусловлена слабой изученностью генетической структуры сибирского бурундука, обитающего на территории России. До настоящего времени большая часть филогенетических исследований были проведены для бурундуков Юго- Восточной Азии и Северной Америки [5-10]. В упомянутых исследованиях обычно используются последовательности генов цито- хрома b (Cyt-b) и цитохромоксидазы субъединицы 1 мтДНК (Co-1).

По нашему мнению, исследования популяций сибирского бурундука Северо- Востока Азии следует начать с изучения генетической изменчивости гена цитохромоксидазы митохондриальной ДНК (мтДНК), поскольку он обычно используется для уточнения систематического положения разных видов животных. Кодируемая этим геном цитохромоксидаза (cytochrome oxidase) - белковый комплекс, который получает электроны от цитохрома с, окисляя его (отсюда и название) и передает электроны кислороду [11]. В своем активном центре, где связывается кислород, цитохромоксидаза содержит комплекс атома железа в составе гемма, помещенного вплотную к связанному атому меди. Именно здесь расходуется поч-ти весь кислород, который мы вдыхаем, в качестве финального акцептора электронов, отданных НАДН в начале электрон-транспортной цепи. Исключительная важность кодируемых указанным геном белковых продуктов для жизнедеятельности клетки привело к обширным исследованиям нуклеотидных последовательностей цитохромоксидазы у разных организмов в рамках международного проекта ДНК - штрихкодирование [12].

Цель работы: определить генетическое разнообразие фрагмента гена цитохромоксидазы митохондриальной ДНК сибирского бурундука, обитающего в окрестностях г. Магадана.

Материалы и методы

Отлов бурундуков проводился ловушками Геро с приманкой (кусочки хлеба, пропитанные растительным маслом): 20-25 ловушек ставились в одну линию через 5 метров; отлов проводился в период с июня по август; ловушки проверялись один раз в день.

В качестве материала для проводимых исследований были собраны 44 образца мышечной ткани азиатского бурундука двух смежных годов. Первая выборка в количестве 24 образцов собрана в 2015 г., вторая выборка, насчитывающая 20 образцов, была собрана в 2016 г. Большая часть особей отловлена в пойменных лиственничниках приустьевого участка р. Дукча и в смешанном лесу долины руч. Веселый, впадающих в Тауйскую губу Охотского моря. Кусочки мышечной ткани фиксировались этанолом. Образцы первой выборки обозначены как «?-2015 TS». Образцы второй выборки обозначены как «?-2016 TS», т. е. в обозначении пробы указан номер особи (? = 1, 2, 3, ...), год сбора материала (2015, 2016) и вид (TS - Tamias sibiricus).

ДНК из тканей выделяли по стандартной методике [13; 14]. Определение нуклеотид- ной последовательности проведено в ОАО «Синтол» (г. Москва). Для полимеразной цепной реакции использовались следующие праймеры: FishF1-5' TTC TCA ACC AAC CAC AAA GAC ATT GG 3', FishR1 5' TAGA CTTCTGGGTGGCCAAAGAATCA 3' [15].

Из двух антипараллельных последовательностей, определенных для каждой особи, получена консенсусная последовательность общей длиной 615 нуклеотидов. Последовательности ДНК были выровнены при помощи программы ClustalW, входящей в пакет MEGA 6.0 [16].

Статистический анализ включал определение числа полиморфных сайтов (s), доли полиморфных сайтов (ps), нуклеотидного (р) и гаплотипического разнообразия (Hd) и величины теста Таджимы (D) [17-19]). Дендрограм- му строили по величинам р - расстояний с использованием метода кластеризации UPGMA. Конструирование дендрограммы выполнено при помощи программы MEGA 6.0.

Результаты и обсуждение

Единое количество нуклеотидов участка гена цитохромоксидазы субьединицы 1 у всех исследованных особей - 643. По комбинациям нуклеотидов в полиморфных сайтах получается 25 гаплотипических групп (табл. 1). Больше всего особей (8) входят в гаплотипическую группу № 6, к ней близки пять особей, не составляющих общий кластер: 8-2016-TS, 12-2015-TS, 2-2016-TS, 7-2016-TS, 5-2016-TS.

Шесть особей составляют вторую по численности гаплотипическую группу № 3, с ней схожи пять особей: 14-2016-TS, 202015-TS, 22-2015-TS, 15-2015-TS, 21-2015TS.Четыре особи группируются в 12-ю гаплотипическую группу. К ней близка близка 9-я гаплотипичес- кая группа из двух особей и особи под номерами 18-2016-TS, 19-2015-TS. Учитывая наследование мтДНК по линии самок, можно предположить, что особи входящие в эти гап- лотипические группы являются потомками трех соответствующих самок-основателей.
Остальные двенадцать бурундуков обнаруживают существенные отличия в нукле- отидных наборах как от вышеупомянутых гаплотипических групп, так и друг от друга в целом.

Наличие 25 гаплотипов связано с точковыми мутациями в исследованных нукле- отидных последовательностях. Статистический анализ показал, что чаще встречаются транзиции (76,81 % замен), чем трансверсии (23,19 %). Вероятность замен одного основания на другое в случае транзиций следующая: С→Т (34,06 %) и Т→С (23,22 %), G→A (12,35 %) и A→G (10,86 %). Наиболее частые трансверсии выявлены в заменах A→T и G→T (по 3,79 %), затем T→A и C→A (по 3,30 %), самые редкие T→G и C→G (по 1,92 %). Точковые мутации могут быть синонимичными и несинонимичными. Синонимичные не приводят к изменению смысла кодона (кодирует определенную аминокислоту или является стоп-кодоном), а несинонимичные изменяют его смысл. Если рассматривать все 44 особи, то тест Таджимы (Tajima) D = -1,941, p < 0,05 показывает, что большинство замен нуклеотидов являются несинонимичными (табл. 2 на с. 24). Скорее всего обнаруженные замены обусловлены селективными процессами происходящими в популяции бурундука г. Магадана.

Для оценки степени генетических отличий между особями были подсчитаны попарные значения р-дистанции. Полученная дендрограмма показывает генетические различия между особями сибирского бурундука (см. дендрограмму на с. 25). Не наблюдается объединения особей по годам сбора материала, т. е. особи, отловленные в 2015 г. не образуют отдельный кластер от особей 2016 г. Данный факт заметен и при вышеуказанном анализе состава гаплотипических группировок.

Показатели генетического разнообразия исследованных выборок приведены в табл. 2 на с. 24. Обращает на себя внимание увеличение генетического разнообразия выборки 2016 г. по сравнению с выборкой 2015 г. По всей видимости в 2016 г. селективные процессы в исследуемой популяции способствовали увеличению частот точковых мутаций в исследуемом фрагменте гена цитох- ромоксидазы мтДНК, что и привело к росту генетического разнообразия. Не исключено влияние миграции особей из других локальных популяций. Как известно, для мелких млекопитающих характерны колебания численности, одной из причин которых могут быть миграционные процессы [20].

Таблица 1
Нуклеотидный набор цитохром оксидазы мтДНКв гаплотипических группах сибирского бурундука

Гаплотипическое разнообразие выборки особей сибирского бурундука, отловленного в окрестностях г. Магадана, аналогично этому же показателю для особей, нуклеотид- ные последовательности которых размещены на интернет-сайте Генетического банка национального центра биотехнологической информации США (National Center for Biotechnology Information, NCBI, www.ncbi.nlm. nih.gov). Повышенный уровень нуклеотидно- го разнообразия у особей из Генетического банка может быть связан с тем, что имеются существенные несовпадения размеров нуклеотидных последовательностей у особей, исследованных разными специалистами.

По мнению систематиков к роду Tamias относится восточный (восточноамерикан- ский) бурундук (Tamias striatus) [21]. Все прочие виды бурундуков отнесены к другому роду (Neotamias). Восточный бурундук обитает на востоке Северной Америки, по образу жизни сходен с сибирским бурундуком [1].

Среди размещенных на сайте Национального центра биотехнологической информации (NCBI) нуклеотидных последовательностях имеются 19, относящихся к по-сле- довательностям фрагмента гена цито- хромоксидазы со-1 восточного бурундука. Наиболее частая длина этих последовательностей - 621 нуклеотид, есть и более короткие последовательности. Исследованные особи восточного бурундука имеют более низкие показатели доли полиморфных сайтов (ps) и генетического разнообразия (см. табл. 2). Причины этого могут быть следующие. Возможно имеет место влияние длины последовательности для оценки величины генетического разнообразия, поскольку для сравниваемых видов есть различия по размерам последовательностей нуклеотидов фрагмента гена цитохромокси- дазы. Можно предположить, что рассматриваемые виды имеют характерные генетические отличия из-за долговременной географической изоляции, поскольку сибирский бурундук обитает в Евразии, а восточный - в Северной Америке.

Таблица 2
Показатели генетического разнообразия фрагмента гена цитохромоксидаза субъединицы 1 мтДНК сибирского бурундука

Примечание. m - количество нуклеотидных последовательностей; s - число полиморфных сайтов; ps - доля полиморфных сайтов; π - нуклеотидное разнообразие; Hd - гаплотипическое разнообразие; D - величина теста Таджимы.
В последних двух строчках таблицы приведены рассчитанные нами значения по данным из Генетического банка [Электронный ресурс]. - Режим доступа: www.ncbi.nlm.nih.gov.

Дендрограмма. Генетическая дифференциация особей сибирского бурундука, обитающего в окрестностях г. Магадана

 

Библиографический список

1. Жизнь животных / под ред. В.Е.Соколова. - М. : Просвещение, 1989. - Т. 7. Млекопитающие. - 558 с.
2. Позвоночные животные Северо-Востока России : монография. - Владивосток : Дальнаука, 1996. - С. 231-232.
3. Чернявский Ф.Б. Млекопитающие Крайнего Северо-Востока Сибири / Ф.Б. Чернявский. - М. : Наука, 1984. - 392 с.
4. Дубинин Е.А. Мелкие млекопитающие города Магадана / Е.А. Дубинин, С.В. Мальков // Вестник СВГУ. - 2012. - Вып. 17. - С. 44-49.
5. Antoinette J. Molecular Phylogeny of the Chipmunk Genus Tamias Based on the Mitochondrial Cytochrome Oxidase Subunit II Gene / J. Antoinette, G. Spicer // Journal of Mammalian Evolution. - 1992. - № 7(3). - C. 429-450.
6. Honeycut R.L. Mammalian mitochondrial DNA evolution: A comprasion of the cytochrome b and Cytochrome oxidase II genes / R.L. Honeycut, M.A. Ned- bal, L.L. Janecek // Journal Moleculary Evolution. - 1995. - № 40. - C. 260-272.
7. Lee Mu-Y. Mitochondrial cytochrome b sequence variations and population structure of Siberian Chipmunk (Tamias sibiricus) in Northeastern Asia and population structure in South Korea / Mu-Y Lee [et al.] // Molecules and Cells. - 2008. - № 26. - P. 566-575.
8. Obolenskaya E.V. Diversity of Palearctic chipmunks (Tamias, Sciuridae) / E.V. Obolenskaya [et al.] // Mammalia. - 2009. - № 73. - P. 281-298.
9. Piaggio A.J. Molecular phylogeny of the Chipmunk genus Tamias based on the mitochondrial cytochrome oxidase subunit II gene / A.J. Piaggio, G.S. Spicer // Journal of Mammalian Evolution. - 2000. - Vol. 7.3. - P. 147-166.
10. Piaggio A.J. Molecular phylogeny of the Chipmunk inferred from mitochondrial cytochrome b and cytochrome oxidase II gene sequences / A.J. Piaggio, G.S. Spicer // Molecular Phylogenetics and Evolution. - 2001. - Vol. 20.3. - P. 335-350.
11. Альбертс Б. Основы молекулярной биологии клетки / Б. Альбертс [и др.]. - М. : БИНОМ. Лаборатория знаний. - 2015. - 768 с.
12. Ratnasingham S. BOLD: The barcode of life datasystem [Электронный ресурс] / S. Ratnasingham, P.D.N. Hebert // Molecular Ecology Notes. - 2007. Doi:10.1111/j.1471-8286.2006.01678.x. - Режим доступа: www.barcodinglife.org.
13. Аксютина С.А. Генетическая изменчивость фрагмента гена цитохромоксидаза мтДНК сибирского бурундука (Tamias sibiricus) / С.А. Аксютина, С.П. Пустовойт // Генетика и разведение животных. - 2017. - № 3. - С. 73-77.
14. Маниатис Т. Методы генетической инженерии. Молекулярное клонирование / Т. Маниатис, Э. Фрич, Дж. Сэмбрук. - М. : Мир, 1984. - 480 с.
15. Ivanova N.V. An inexpensive, automation-friendly protocol for recovering high-quality DNA / N.V. Ivanova, J.R. De Waard, P.D.H. Hebert // Molecular Ecology Notes. - 2006. - P. 1-5. (doi: 10.1111 /j .1471-8286. 2006. 01748.x)/
16. Tamura K. MEGA6: MEGA: Molecular Evolutionary Genetics Analysis version 6.0 / К. Tamura [et al.] // Molecular Biology and Evolution. - 2013. - № 30. - P. 2725-2729.
17. Лукашов В.В. Молекулярная эволюция и филогенетический анализ / В.В. Лукашов. - М.: БИНОМ. Лаборатория знаний, 2009. - 256 с.
18. Nei M. Molecular evolution and phylogenetics / M. Nei, S. Kumar. - Oxford University Press, 2000. - 333 p.
19. Librado P. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data / P. Librado, J. Rozas // Bioinformatics. - 2009. - № 25. - P. 1451-1452.
20. Ямборко А.В. Нециклическая динамика численности мелких млекопитающих: гипотеза зависимых популяций / А.В. Ямборко // Геология, география, биологическое разнообразие и ресурсы Северо- Востока России : материалы III Всерос. конф., посвящ. памяти А.П. Васьковского и в честь его 105-летия. - Магадан : СВКНИИ ДВО РАН, 2016. - С. 302-305.
21. Павлинов И.Я. Систематика современных млекопитающих / И.Я. Павлинов. - М. : Моск. ун-т., 2003. - 297 с.

Источник: Научный журнал "Вестник Северо-Восточного государственного университета" 2018. - Вып. 30.


Категория: Животные. Зоотехника | Добавил: x5443 (10.07.2019)
Просмотров: 12 | Теги: бурундук | Рейтинг: 0.0/0
Всего комментариев: 0
Добавлять комментарии могут только зарегистрированные пользователи.
[ Регистрация | Вход ]
...




Copyright MyCorp © 2019 Обратная связь